[
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_triangle_area\", \"description\": \"Calculate the area of a triangle given its base and height. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"base\": {\"type\": \"integer\", \"description\": \"The base of the triangle.\"}, \"height\": {\"type\": \"integer\", \"description\": \"The height of the triangle.\"}, \"unit\": {\"type\": \"string\", \"description\": \"The unit of measure (defaults to 'units' if not specified)\"}}, \"required\": [\"base\", \"height\"]}}}\n```\n<|User|>Find the area of a triangle with a base of 10 units and height of 5 units.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"solve_quadratic_equation\", \"description\": \"Function solves the quadratic equation and returns its roots. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"a\": {\"type\": \"integer\", \"description\": \"Coefficient of x squared\"}, \"b\": {\"type\": \"integer\", \"description\": \"Coefficient of x\"}, \"c\": {\"type\": \"integer\", \"description\": \"Constant term in the quadratic equation.\"}}, \"required\": [\"a\", \"b\", \"c\"]}}}\n```\n<|User|>Solve a quadratic equation where a=2, b=6, and c=5<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"geometry_circumference\", \"description\": \"Calculate the circumference of a circle given the radius. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"radius\": {\"type\": \"integer\", \"description\": \"The radius of the circle.\"}, \"units\": {\"type\": \"string\", \"description\": \"Units for the output circumference measurement. Default is 'cm'.\"}}, \"required\": [\"radius\"]}}}\n```\n<|User|>Calculate the circumference of a circle with radius 3<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"integrate\", \"description\": \"Calculate the area under a curve for a specified function between two x values. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"function\": {\"type\": \"string\", \"description\": \"The function to integrate, represented as a string. For example, 'x^3'\"}, \"start_x\": {\"type\": \"integer\", \"description\": \"The starting x-value to integrate over.\"}, \"end_x\": {\"type\": \"integer\", \"description\": \"The ending x-value to integrate over.\"}, \"method\": {\"type\": \"string\", \"description\": \"The method of numerical integration to use. Choices are 'trapezoid' or 'simpson'. Default is 'trapezoid'.\"}}, \"required\": [\"function\", \"start_x\", \"end_x\"]}}}\n```\n<|User|>Calculate the area under the curve from x = -2 to x = 3 for the function y = x^3 using simpson method.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculus_derivative\", \"description\": \"Compute the derivative of a function at a specific value. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"function\": {\"type\": \"string\", \"description\": \"The function to calculate the derivative of.\"}, \"value\": {\"type\": \"integer\", \"description\": \"The value where the derivative needs to be calculated at.\"}, \"function_variable\": {\"type\": \"string\", \"description\": \"The variable present in the function, for instance x or y, etc. Default is 'x'.\"}}, \"required\": [\"function\", \"value\"]}}}\n```\n<|User|>Calculate the derivative of the function 2x^2 at x = 1.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"math_gcd\", \"description\": \"Calculate the greatest common divisor of two integers. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"num1\": {\"type\": \"integer\", \"description\": \"First number.\"}, \"num2\": {\"type\": \"integer\", \"description\": \"Second number.\"}}, \"required\": [\"num1\", \"num2\"]}}}\n```\n<|User|>Find the greatest common divisor (GCD) of 12 and 18<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_displacement\", \"description\": \"Calculates the displacement of an object in motion given initial velocity, time, and acceleration. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"initial_velocity\": {\"type\": \"integer\", \"description\": \"The initial velocity of the object in m/s.\"}, \"time\": {\"type\": \"integer\", \"description\": \"The time in seconds that the object has been in motion.\"}, \"acceleration\": {\"type\": \"number\", \"description\": \"The acceleration of the object in m/s^2. This is a float type value.\", \"default\": 0, \"format\": \"float\"}}, \"required\": [\"initial_velocity\", \"time\"]}}}\n```\n<|User|>Calculate the displacement of a car given the initial velocity of 10 and acceleeration of 9.8 within 5 seconds.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_magnetic_field\", \"description\": \"Calculate the magnetic field produced at the center of a circular loop carrying current. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"current\": {\"type\": \"integer\", \"description\": \"The current through the circular loop in Amperes.\"}, \"radius\": {\"type\": \"integer\", \"description\": \"The radius of the circular loop in meters.\"}, \"permeability\": {\"type\": \"number\", \"description\": \"The magnetic permeability. Default is 12.57e10 (Vacuum Permeability). This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"current\", \"radius\"]}}}\n```\n<|User|>Calculate the magnetic field produced at the center of a circular loop carrying current of 5 Ampere with a radius of 4 meters<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"thermo_calculate_energy\", \"description\": \"Calculate the energy required or released during a phase change using mass, the phase transition temperature and the specific latent heat. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"mass\": {\"type\": \"integer\", \"description\": \"Mass of the substance in grams.\"}, \"phase_transition\": {\"type\": \"string\", \"description\": \"Phase transition. Can be 'melting', 'freezing', 'vaporization', 'condensation'.\"}, \"substance\": {\"type\": \"string\", \"description\": \"The substance which is undergoing phase change, default is 'water'\"}}, \"required\": [\"mass\", \"phase_transition\"]}}}\n```\n<|User|>Calculate the energy (in Joules) absorbed or released during the phase change of 100g of water from liquid to steam at its boiling point.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_final_temperature\", \"description\": \"Calculates the final equilibrium temperature after mixing two bodies with different masses and temperatures Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"mass1\": {\"type\": \"integer\", \"description\": \"The mass of the first body (kg).\"}, \"temperature1\": {\"type\": \"integer\", \"description\": \"The initial temperature of the first body (Celsius).\"}, \"mass2\": {\"type\": \"integer\", \"description\": \"The mass of the second body (kg).\"}, \"temperature2\": {\"type\": \"integer\", \"description\": \"The initial temperature of the second body (Celsius).\"}, \"specific_heat_capacity\": {\"type\": \"number\", \"description\": \"The specific heat capacity of the bodies in kJ/kg/K. If not provided, will default to that of water at room temperature, which is 4.2 kJ/kg/K. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"mass1\", \"temperature1\", \"mass2\", \"temperature2\"]}}}\n```\n<|User|>Calculate the final temperature when 20 kg of water at 30 degree Celsius is mixed with 15 kg of water at 60 degree Celsius.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_boiling_melting_points\", \"description\": \"Retrieve the boiling point and melting point of a substance based on its name and the sea level. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"substance\": {\"type\": \"string\", \"description\": \"The name of the substance.\"}, \"sea_level\": {\"type\": \"integer\", \"description\": \"The sea level in meters.\"}}, \"required\": [\"substance\", \"sea_level\"]}}}\n```\n<|User|>Find the boiling point and melting point of water under the sea level of 5000m.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calc_absolute_pressure\", \"description\": \"Calculates the absolute pressure from gauge and atmospheric pressures. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"atm_pressure\": {\"type\": \"integer\", \"description\": \"The atmospheric pressure in atmospheres (atm). Default is 1 atm if not provided.\"}, \"gauge_pressure\": {\"type\": \"integer\", \"description\": \"The gauge pressure in atmospheres (atm). Must be provided.\"}}, \"required\": [\"gauge_pressure\"]}}}\n```\n<|User|>Calculate the absolute pressure in pascals given atmospheric pressure of 1 atm and a gauge pressure of 2 atm.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calc_heat_capacity\", \"description\": \"Calculate the heat capacity at constant pressure of air using its temperature and volume. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"temp\": {\"type\": \"integer\", \"description\": \"The temperature of the gas in Kelvin.\"}, \"volume\": {\"type\": \"integer\", \"description\": \"The volume of the gas in m^3.\"}, \"gas\": {\"type\": \"string\", \"description\": \"Type of gas, with 'air' as default.\"}}, \"required\": [\"temp\", \"volume\"]}}}\n```\n<|User|>Calculate the heat capacity at constant pressure for air, given its temperature is 298K and volume is 10 m^3.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"fetch_DNA_sequence\", \"description\": \"Retrieve the sequence of a DNA molecule with the given id from a public database. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"DNA_id\": {\"type\": \"string\", \"description\": \"Unique ID of the DNA molecule in the database.\"}, \"format\": {\"type\": \"string\", \"description\": \"Optional parameter to get sequence in specific format (default to 'fasta').\"}, \"upstream\": {\"type\": \"integer\", \"description\": \"Optional parameter to include certain number of base pairs upstream the DNA sequence (default to 0).\"}}, \"required\": [\"DNA_id\"]}}}\n```\n<|User|>Retrieve the sequence of DNA molecule with id `DNA123`.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"biology_get_cell_info\", \"description\": \"Retrieve information about the structure and functioning of a specified type of cell Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"cell_type\": {\"type\": \"string\", \"description\": \"Type of cell you want information about\"}, \"detailed\": {\"type\": \"boolean\", \"description\": \"Indicate if you want a detailed description of the cell\", \"default\": \"false\"}}, \"required\": [\"cell_type\"]}}}\n```\n<|User|>Find me detailed information about the structure of human cell<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_cell_density\", \"description\": \"Calculate the cell density of a biological sample based on its optical density and the experiment dilution. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"optical_density\": {\"type\": \"number\", \"description\": \"The optical density of the sample, usually obtained from a spectrophotometer reading. This is a float type value.\", \"format\": \"float\"}, \"dilution\": {\"type\": \"integer\", \"description\": \"The dilution factor applied during the experiment.\"}, \"calibration_factor\": {\"type\": \"number\", \"description\": \"The calibration factor to adjust the density, default value is 1e9 assuming cell density is in CFU/mL. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"optical_density\", \"dilution\"]}}}\n```\n<|User|>Calculate the cell density in a sample with an optical density of 0.6, where the experiment dilution is 5 times.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"analyze_dna_sequence\", \"description\": \"Analyzes the DNA sequence based on a reference sequence and return any potential mutations. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"sequence\": {\"type\": \"string\", \"description\": \"The DNA sequence to be analyzed.\"}, \"reference_sequence\": {\"type\": \"string\", \"description\": \"The reference DNA sequence.\"}, \"mutation_type\": {\"type\": \"string\", \"enum\": [\"insertion\", \"deletion\", \"substitution\"], \"description\": \"Type of the mutation to be looked for in the sequence. Default to 'substitution'.\"}}, \"required\": [\"sequence\", \"reference_sequence\"]}}}\n```\n<|User|>Analyze the DNA sequence 'AGTCGATCGAACGTACGTACG' for any potential substitution mutations based on a reference sequence 'AGTCCATCGAACGTACGTACG'.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"ecology_data_precipitation_stats\", \"description\": \"Retrieve precipitation data for a specified location and time period. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The name of the location, e.g., 'Amazon rainforest'.\"}, \"time_frame\": {\"type\": \"string\", \"enum\": [\"six_months\", \"year\", \"five_years\"], \"description\": \"The time period for which data is required.\"}}, \"required\": [\"location\", \"time_frame\"]}}}\n```\n<|User|>Get me data on average precipitation in the Amazon rainforest for the last six months.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"identify_bird\", \"description\": \"Identify a bird species based on certain characteristics. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"color\": {\"type\": \"string\", \"description\": \"Color of the bird.\"}, \"habitat\": {\"type\": \"string\", \"description\": \"Habitat of the bird.\"}, \"size\": {\"type\": \"string\", \"enum\": [\"small\", \"medium\", \"large\"], \"description\": \"Size of the bird. Default is 'small'\"}}, \"required\": [\"color\", \"habitat\"]}}}\n```\n<|User|>Identify a small green bird in forest.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"forest_growth_forecast\", \"description\": \"Predicts the forest growth over the next N years based on current trends. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The location where you want to predict forest growth.\"}, \"years\": {\"type\": \"integer\", \"description\": \"The number of years for the forecast.\"}, \"include_human_impact\": {\"type\": \"boolean\", \"description\": \"Whether or not to include the impact of human activities in the forecast. If not provided, defaults to false.\"}}, \"required\": [\"location\", \"years\"]}}}\n```\n<|User|>Predict the growth of forest in Yellowstone National Park for the next 5 years including human impact.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_fitness\", \"description\": \"Calculate the expected evolutionary fitness of a creature based on the individual values and contributions of its traits. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"trait_values\": {\"type\": \"array\", \"items\": {\"type\": \"number\"}, \"description\": \"List of trait values, which are decimal numbers between 0 and 1, where 1 represents the trait maximally contributing to fitness.\"}, \"trait_contributions\": {\"type\": \"array\", \"items\": {\"type\": \"number\"}, \"description\": \"List of the percentage contributions of each trait to the overall fitness, which must sum to 1.\"}}, \"required\": [\"trait_values\", \"trait_contributions\"]}}}\n```\n<|User|>Calculate the expected evolutionary fitness of a creature, with trait A contributing to 40% of the fitness and trait B contributing 60%, if trait A has a value of 0.8 and trait B a value of 0.7.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"population_projections\", \"description\": \"Calculates the projected population growth based on the current growth rate. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"country\": {\"type\": \"string\", \"description\": \"The country for which to calculate the population projection.\"}, \"years\": {\"type\": \"integer\", \"description\": \"Number of years for the projection.\"}, \"growth_rate\": {\"type\": \"number\", \"description\": \"Optional parameter to specify the growth rate, in percentage. Default is 1.2. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"country\", \"years\"]}}}\n```\n<|User|>What's the projected population growth in United States in the next 20 years?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_bacteria_evolution_rate\", \"description\": \"Calculate the evolution rate of bacteria given the starting number, duplication frequency and total duration. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"start_population\": {\"type\": \"integer\", \"description\": \"The starting population of bacteria.\"}, \"duplication_frequency\": {\"type\": \"integer\", \"description\": \"The frequency of bacteria duplication per hour.\"}, \"duration\": {\"type\": \"integer\", \"description\": \"Total duration in hours.\"}, \"generation_time\": {\"type\": \"integer\", \"description\": \"The average generation time of the bacteria in minutes. Default is 20 minutes\"}}, \"required\": [\"start_population\", \"duplication_frequency\", \"duration\"]}}}\n```\n<|User|>Calculate the evolution rate of a bacteria population, start with 5000 bacteria, each bacteria duplicates every hour for 6 hours.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"elephant_population_estimate\", \"description\": \"Estimate future population of elephants given current population and growth rate. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"current_population\": {\"type\": \"integer\", \"description\": \"The current number of elephants.\"}, \"growth_rate\": {\"type\": \"number\", \"description\": \"The annual population growth rate of elephants. This is a float type value.\", \"format\": \"float\"}, \"years\": {\"type\": \"integer\", \"description\": \"The number of years to project the population.\"}}, \"required\": [\"current_population\", \"growth_rate\", \"years\"]}}}\n```\n<|User|>Estimate the population size of elephants of 35000 in the next 5 years given the current growth rate of 0.015.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"create_histogram\", \"description\": \"Create a histogram based on provided data. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"data\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}, \"description\": \"The data for which histogram needs to be plotted.\"}, \"bins\": {\"type\": \"integer\", \"description\": \"The number of equal-width bins in the range. Default is 10.\"}}, \"required\": [\"data\", \"bins\"]}}}\n```\n<|User|>Create a histogram for student scores with the following data: 85, 90, 88, 92, 86, 89, 91 and set bin range to 5.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"map_routing_fastest_route\", \"description\": \"Finds the fastest route from one location to another, with an option to avoid toll roads. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"start_location\": {\"type\": \"string\", \"description\": \"The starting location for the journey.\"}, \"end_location\": {\"type\": \"string\", \"description\": \"The destination for the journey.\"}, \"avoid_tolls\": {\"type\": \"boolean\", \"description\": \"Option to avoid toll roads during the journey. Default is false.\"}}, \"required\": [\"start_location\", \"end_location\"]}}}\n```\n<|User|>Find the fastest route from San Francisco to Los Angeles with toll roads avoided.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_distance\", \"description\": \"Calculate the distance between two GPS coordinates. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"coord1\": {\"type\": \"array\", \"description\": \"The first coordinate as (latitude, longitude).\", \"items\": {\"type\": \"number\"}}, \"coord2\": {\"type\": \"array\", \"description\": \"The second coordinate as (latitude, longitude).\", \"items\": {\"type\": \"number\"}}, \"unit\": {\"type\": \"string\", \"description\": \"The unit of distance. Options: 'miles', 'kilometers'.\"}}, \"required\": [\"coord1\", \"coord2\", \"unit\"]}}}\n```\n<|User|>Calculate the distance between two GPS coordinates (33.4484 N, 112.0740 W) and (34.0522 N, 118.2437 W) in miles.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_BMI\", \"description\": \"Calculate the Body Mass Index (BMI) given a person's weight and height. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"weight_kg\": {\"type\": \"integer\", \"description\": \"The weight of the person in kilograms.\"}, \"height_m\": {\"type\": \"number\", \"description\": \"The height of the person in meters. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"weight_kg\", \"height_m\"]}}}\n```\n<|User|>Calculate the BMI (Body Mass Index) of a person who weighs 70kg and is 1.75m tall.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"db_fetch_records\", \"description\": \"Fetch records from a specified database table based on certain conditions. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"database_name\": {\"type\": \"string\", \"description\": \"The name of the database.\"}, \"table_name\": {\"type\": \"string\", \"description\": \"The name of the table from which records need to be fetched.\"}, \"conditions\": {\"type\": \"object\", \"properties\": {\"department\": {\"type\": \"string\", \"description\": \"The name of the department of students.\"}, \"school\": {\"type\": \"string\", \"description\": \"The name of the school students are enrolled in.\"}}, \"description\": \"The conditions based on which records are to be fetched.\"}, \"fetch_limit\": {\"type\": \"integer\", \"description\": \"Limits the number of records to be fetched. Default is 0, which means no limit.\"}}, \"required\": [\"database_name\", \"table_name\", \"conditions\"]}}}\n```\n<|User|>Fetch all records for students studying Science in 'Bluebird High School' from the StudentDB.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"employee_fetch_data\", \"description\": \"Fetches the detailed data for a specific employee in a given company. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"company_name\": {\"type\": \"string\", \"description\": \"The name of the company.\"}, \"employee_id\": {\"type\": \"integer\", \"description\": \"The unique ID of the employee.\"}, \"data_field\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"Personal Info\", \"Job History\", \"Payroll\", \"Attendance\"]}, \"description\": \"Fields of data to be fetched for the employee (Optional). Default is ['Personal Info']\"}}, \"required\": [\"company_name\", \"employee_id\"]}}}\n```\n<|User|>Retrieve Personal Info and Job History data of a specific employee whose ID is 345 in company 'ABC Ltd.'<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_restaurant\", \"description\": \"Retrieve highest rated restaurant given cuisine, location, and a condition. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"cuisine\": {\"type\": \"string\", \"description\": \"Cuisine of the restaurant.\"}, \"location\": {\"type\": \"string\", \"description\": \"City where restaurant is located.\"}, \"condition\": {\"type\": \"string\", \"description\": \"Condition to be met by the restaurant (e.g., operating days, amenities, etc.)\"}}, \"required\": [\"cuisine\", \"location\", \"condition\"]}}}\n```\n<|User|>Get the highest rated sushi restaurant in Boston, that opens on Sundays.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_theater_movie_releases\", \"description\": \"Retrieve the list of movie releases in specific theaters for a specified period. in the format of city shorten name like SF. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The location of the theaters.\"}, \"timeframe\": {\"type\": \"integer\", \"description\": \"The number of days for which releases are required from current date.\"}, \"format\": {\"type\": \"string\", \"description\": \"Format of movies - could be 'IMAX', '2D', '3D', '4DX' etc. Default is 'all'\"}}, \"required\": [\"location\", \"timeframe\"]}}}\n```\n<|User|>Fetch me the list of IMAX movie releases in theaters near LA for the next week.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"database_query\", \"description\": \"Query the database based on certain conditions. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"table\": {\"type\": \"string\", \"description\": \"Name of the table to query.\"}, \"conditions\": {\"type\": \"array\", \"items\": {\"type\": \"object\", \"properties\": {\"field\": {\"type\": \"string\", \"description\": \"The field to apply the condition.\"}, \"operation\": {\"type\": \"string\", \"description\": \"The operation to be performed.\", \"enum\": [\"<\", \">\", \"=\", \">=\", \"<=\"]}, \"value\": {\"type\": \"string\", \"description\": \"The value to be compared.\"}}, \"required\": [\"field\", \"operation\", \"value\"]}, \"description\": \"Conditions for the query.\"}}, \"required\": [\"table\", \"conditions\"]}}}\n```\n<|User|>Find records in database in user table where age is greater than 25 and job is 'engineer'.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"math_factorial\", \"description\": \"Calculate the factorial of a given number. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"number\": {\"type\": \"integer\", \"description\": \"The number to compute factorial.\"}}, \"required\": [\"number\"]}}}\n```\n<|User|>Calculate the factorial of the number 5<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_clock_angle\", \"description\": \"Calculate the angle between the hour and minute hands of a clock at a given time. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"hours\": {\"type\": \"integer\", \"description\": \"The hour on the clock face.\"}, \"minutes\": {\"type\": \"integer\", \"description\": \"The minutes on the clock face.\"}, \"round_to\": {\"type\": \"integer\", \"description\": \"The number of decimal places to round the result to, default is 2.\"}}, \"required\": [\"hours\", \"minutes\"]}}}\n```\n<|User|>What will be the angle between the hour and minute hands of a clock at 6:30 PM?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"light_travel_time\", \"description\": \"Calculate the time taken for light to travel from a celestial body to another. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"distance_in_light_years\": {\"type\": \"integer\", \"description\": \"The distance between the two celestial bodies in light years.\"}, \"speed_of_light\": {\"type\": \"integer\", \"description\": \"The speed of light in vacuum, in m/s. Default value is 299792458 m/s.\"}}, \"required\": [\"distance_in_light_years\"]}}}\n```\n<|User|>How much time will it take for the light to reach earth from a star 4 light years away?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_distance\", \"description\": \"Calculate the distance between two celestial bodies. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"body1\": {\"type\": \"string\", \"description\": \"The first celestial body.\"}, \"body2\": {\"type\": \"string\", \"description\": \"The second celestial body.\"}, \"unit\": {\"type\": \"string\", \"description\": \"The unit of measurement, default is 'km'.\"}}, \"required\": [\"body1\", \"body2\"]}}}\n```\n<|User|>What's the distance in milesfrom the Earth to the Moon?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"run_linear_regression\", \"description\": \"Build a linear regression model using given predictor variables and a target variable. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"predictors\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"Array containing the names of predictor variables.\"}, \"target\": {\"type\": \"string\", \"description\": \"The name of target variable.\"}, \"standardize\": {\"type\": \"boolean\", \"description\": \"Option to apply standardization on the predictors. Defaults to False.\"}}, \"required\": [\"predictors\", \"target\"]}}}\n```\n<|User|>Run a linear regression model with predictor variables 'Age', 'Income' and 'Education' and a target variable 'Purchase_Amount'. Also apply standardization.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"random_forest_train\", \"description\": \"Train a Random Forest Model on given data Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"n_estimators\": {\"type\": \"integer\", \"description\": \"The number of trees in the forest.\"}, \"max_depth\": {\"type\": \"integer\", \"description\": \"The maximum depth of the tree.\"}, \"data\": {\"type\": \"string\", \"description\": \"The training data for the model.\"}}, \"required\": [\"n_estimators\", \"max_depth\", \"data\"]}}}\n```\n<|User|>Generate a random forest model with 100 trees and a depth of 5 on the provided data my_data.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_probability\", \"description\": \"Calculate the probability of an event. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"total_outcomes\": {\"type\": \"integer\", \"description\": \"Total number of possible outcomes.\"}, \"favorable_outcomes\": {\"type\": \"integer\", \"description\": \"Number of outcomes considered as 'successful'.\"}, \"round_to\": {\"type\": \"integer\", \"description\": \"Number of decimal places to round the result to.\", \"default\": 2}}, \"required\": [\"total_outcomes\", \"favorable_outcomes\"]}}}\n```\n<|User|>Calculate the probability of drawing a king from a deck of cards.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"probability_of_event\", \"description\": \"Calculates the probability of an event. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"success_outcomes\": {\"type\": \"integer\", \"description\": \"The number of successful outcomes.\"}, \"total_outcomes\": {\"type\": \"integer\", \"description\": \"The total number of possible outcomes.\"}, \"format_as_ratio\": {\"type\": \"boolean\", \"description\": \"When true, formats the output as a ratio instead of a decimal. Default is false.\"}}, \"required\": [\"success_outcomes\", \"total_outcomes\"]}}}\n```\n<|User|>What are the odds of pulling a heart suit from a well-shuffled standard deck of 52 cards? Format it as ratio.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"run_two_sample_ttest\", \"description\": \"Runs a two sample t-test for two given data groups. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"group1\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}, \"description\": \"First group of data points.\"}, \"group2\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}, \"description\": \"Second group of data points.\"}, \"equal_variance\": {\"type\": \"boolean\", \"description\": \"Assumption about whether the two samples have equal variance.\", \"default\": true}}, \"required\": [\"group1\", \"group2\"]}}}\n```\n<|User|>Run a two sample T-test to compare the average of Group A [3, 4, 5, 6, 4] and Group B [7, 8, 9, 8, 7] assuming equal variance.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"chi_squared_test\", \"description\": \"Performs a Chi-Squared test for independence on a 2x2 contingency table. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"table\": {\"type\": \"array\", \"items\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}}, \"description\": \"A 2x2 contingency table presented in array form.\"}, \"alpha\": {\"type\": \"number\", \"description\": \"Significance level for the Chi-Squared test. Default is 0.05. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"table\"]}}}\n```\n<|User|>Perform a Chi-Squared test for independence on a 2x2 contingency table [ [10, 20], [30, 40] ]<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"hypothesis_testing_two_sample_t_test\", \"description\": \"Perform a two-sample t-test to determine if there is a significant difference between the means of two independent samples. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"group1\": {\"type\": \"array\", \"items\": {\"type\": \"number\"}, \"description\": \"Sample observations from group 1.\"}, \"group2\": {\"type\": \"array\", \"items\": {\"type\": \"number\"}, \"description\": \"Sample observations from group 2.\"}, \"alpha\": {\"type\": \"number\", \"description\": \"Significance level for the t-test. Default is 0.05. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"group1\", \"group2\"]}}}\n```\n<|User|>Perform a two-sample t-test to determine if there is a significant difference between the mean of group1 (e.g., 12.4, 15.6, 11.2, 18.9) and group2 (e.g., 10.5, 9.8, 15.2, 13.8) at the significance level 0.05.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"predict_house_price\", \"description\": \"Predict house price based on area, number of rooms and year of construction. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"area\": {\"type\": \"integer\", \"description\": \"Area of the house in square feet.\"}, \"rooms\": {\"type\": \"integer\", \"description\": \"Number of rooms in the house.\"}, \"year\": {\"type\": \"integer\", \"description\": \"Year when the house was constructed.\"}, \"location\": {\"type\": \"string\", \"description\": \"The location or city of the house.\"}}, \"required\": [\"area\", \"rooms\", \"year\", \"location\"]}}}\n```\n<|User|>Predict house price in San Francisco based on its area of 2500 square feet, number of rooms as 5 and year of construction is 1990.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_NPV\", \"description\": \"Calculate the NPV (Net Present Value) of an investment, considering a series of future cash flows, discount rate, and an initial investment. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"cash_flows\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}, \"description\": \"Series of future cash flows.\"}, \"discount_rate\": {\"type\": \"number\", \"description\": \"The discount rate to use. This is a float type value.\", \"format\": \"float\"}, \"initial_investment\": {\"type\": \"integer\", \"description\": \"The initial investment. Default is 0 if not specified.\"}}, \"required\": [\"cash_flows\", \"discount_rate\"]}}}\n```\n<|User|>Find the Net Present Value (NPV) of an investment, given cash_flows=[200,300,400,500], a discount rate of 10%, and an initial investment of $2000.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_return_on_equity\", \"description\": \"Calculate a company's return on equity based on its net income, shareholder's equity, and dividends paid. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"net_income\": {\"type\": \"integer\", \"description\": \"The company's net income.\"}, \"shareholder_equity\": {\"type\": \"integer\", \"description\": \"The company's total shareholder's equity.\"}, \"dividends_paid\": {\"type\": \"integer\", \"description\": \"The total dividends paid by the company. Optional. If not given, default to 0.\"}}, \"required\": [\"net_income\", \"shareholder_equity\"]}}}\n```\n<|User|>Calculate the company's return on equity given its net income of $2,000,000, shareholder's equity of $10,000,000, and dividends paid of $200,000.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_return_on_investment\", \"description\": \"Calculate the return on investment for a given stock based on its purchase price, sale price, and any dividends received. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"purchase_price\": {\"type\": \"integer\", \"description\": \"The price the stock was bought at.\"}, \"sale_price\": {\"type\": \"integer\", \"description\": \"The price the stock was sold at.\"}, \"dividend\": {\"type\": \"integer\", \"description\": \"Any dividends received from the stock.\", \"default\": 0}}, \"required\": [\"purchase_price\", \"sale_price\"]}}}\n```\n<|User|>Calculate the return on investment for a stock bought at $20, sold at $25, with a dividend of $2.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_stock_return\", \"description\": \"Calculate the projected return of a stock investment given the investment amount, the annual growth rate and holding period in years. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"investment_amount\": {\"type\": \"integer\", \"description\": \"The amount of money to invest.\"}, \"annual_growth_rate\": {\"type\": \"number\", \"description\": \"The expected annual growth rate of the stock. This is a float type value.\", \"format\": \"float\"}, \"holding_period\": {\"type\": \"integer\", \"description\": \"The number of years you intend to hold the stock.\"}, \"dividends\": {\"type\": \"boolean\", \"description\": \"Optional. True if the calculation should take into account potential dividends. Default is false.\"}}, \"required\": [\"investment_amount\", \"annual_growth_rate\", \"holding_period\"]}}}\n```\n<|User|>Calculate the projected return on a $5000 investment in ABC company's stock, if the expected annual growth rate is 6% and the holding period is 5 years.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_stock_prices\", \"description\": \"Retrieves stock prices for specified companies and duration. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"companies\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"List of companies to retrieve stock prices for.\"}, \"duration\": {\"type\": \"string\", \"description\": \"Time duration to retrieve stock prices for. E.g., '1 week', '2 weeks', '1 month', etc.\"}}, \"required\": [\"companies\", \"duration\"]}}}\n```\n<|User|>Retrieve stock prices of Microsoft and Google for the last 2 weeks.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_roi\", \"description\": \"Calculate the return on investment for a given deposit amount, annual interest rate, and time frame. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"deposit\": {\"type\": \"integer\", \"description\": \"The initial deposit amount.\"}, \"annual_interest_rate\": {\"type\": \"number\", \"description\": \"The annual interest rate provided by the bank. This is a float type value.\", \"format\": \"float\"}, \"years\": {\"type\": \"integer\", \"description\": \"The period for which the money is invested.\"}}, \"required\": [\"deposit\", \"annual_interest_rate\", \"years\"]}}}\n```\n<|User|>Calculate the return of investment of a bank's savings account with a deposit of $1000, annual interest rate of 3% for 1 year.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"highest_grossing_banks\", \"description\": \"Retrieve the highest grossing banks in a specified country and year. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"country\": {\"type\": \"string\", \"description\": \"The country to get the data from.\"}, \"year\": {\"type\": \"integer\", \"description\": \"The year to get the data from.\"}, \"top_n\": {\"type\": \"integer\", \"description\": \"Top n banks in terms of grossing. Default is 5\"}}, \"required\": [\"country\", \"year\"]}}}\n```\n<|User|>Find the highest grossing bank in the U.S for year 2020.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"crime_record_get_record\", \"description\": \"Retrieve detailed felony crime records using a specific case number and location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_number\": {\"type\": \"string\", \"description\": \"The case number related to the crime.\"}, \"county\": {\"type\": \"string\", \"description\": \"The county in which the crime occurred.\"}, \"details\": {\"type\": \"boolean\", \"description\": \"To get a detailed report, set as true. Defaults to false.\"}}, \"required\": [\"case_number\", \"county\"]}}}\n```\n<|User|>Look up details of a felony crime record for case number CA123456 in San Diego County<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_act_details\", \"description\": \"Retrieve the details of a particular legal act based on its name and year of amendment if any. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"act_name\": {\"type\": \"string\", \"description\": \"The name of the act.\"}, \"amendment_year\": {\"type\": \"integer\", \"description\": \"Year of amendment if any. If not provided, the latest amendment year will be considered.\"}}, \"required\": [\"act_name\", \"amendment_year\"]}}}\n```\n<|User|>Give me the details of Criminal Law Amendment Act of 2013.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_case_info\", \"description\": \"Retrieve case details using a specific case docket number and court location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"docket\": {\"type\": \"string\", \"description\": \"Docket number for the specific court case.\"}, \"court\": {\"type\": \"string\", \"description\": \"Court in which the case was heard.\"}, \"info_type\": {\"type\": \"string\", \"description\": \"Specify the information type needed for the case. i.e., victim, accused, verdict etc.\"}}, \"required\": [\"docket\", \"court\", \"info_type\"]}}}\n```\n<|User|>Who was the victim in the case docket numbered 2022/AL2562 in California?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"civil_cases_retrieve\", \"description\": \"Retrieve civil cases based on given parameters, including year, crime type, and location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"year\": {\"type\": \"integer\", \"description\": \"Year of the cases\"}, \"crime_type\": {\"type\": \"string\", \"description\": \"Type of the crime.\"}, \"location\": {\"type\": \"string\", \"description\": \"Location of the case in the format of city name.\"}}, \"required\": [\"year\", \"crime_type\", \"location\"]}}}\n```\n<|User|>Retrieve cases from 2020 about theft crimes in Los Angeles, California<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"court_case_search\", \"description\": \"Retrieves details about a court case using its docket number and location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"docket_number\": {\"type\": \"string\", \"description\": \"The docket number for the case.\"}, \"location\": {\"type\": \"string\", \"description\": \"The location where the case is registered, in the format: state, e.g., Texas\"}, \"full_text\": {\"type\": \"boolean\", \"default\": \"false\", \"description\": \"Option to return the full text of the case ruling.\"}}, \"required\": [\"docket_number\", \"location\"]}}}\n```\n<|User|>Find the details of the court case identified by docket number 123456 in Texas. Don't return full text<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"fetch_law_case_details\", \"description\": \"Fetch details of a specific law case based on case number, year and court. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_number\": {\"type\": \"integer\", \"description\": \"The specific number of the law case.\"}, \"court\": {\"type\": \"string\", \"description\": \"The city name where the court takes place\"}, \"year\": {\"type\": \"integer\", \"description\": \"The year in which the law case took place.\"}}, \"required\": [\"case_number\", \"court\", \"year\"]}}}\n```\n<|User|>Fetch details of a law case with number 43403 in New York court for year 2018.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"legal_case_fetch\", \"description\": \"Fetch detailed legal case information from database. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_id\": {\"type\": \"string\", \"description\": \"The ID of the legal case.\"}, \"details\": {\"type\": \"boolean\", \"description\": \"True if need the detail info. \"}}, \"required\": [\"case_id\", \"details\"]}}}\n```\n<|User|>How to obtain the detailed case information of the 'R vs Adams' legal case?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"law_case_search\", \"description\": \"Search and retrieve law cases based on the topic, timeline, and location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"topic\": {\"type\": \"string\", \"description\": \"The subject matter of the case.\"}, \"year_range\": {\"type\": \"array\", \"items\": {\"type\": \"integer\"}, \"description\": \"The start and end year for searching cases.\"}, \"location\": {\"type\": \"string\", \"description\": \"The location where the case is being heard.\"}, \"judicial_system\": {\"type\": \"string\", \"description\": \"The specific judicial system in which to search (e.g. 'federal', 'state').\", \"default\": \"all\"}}, \"required\": [\"topic\", \"year_range\", \"location\"]}}}\n```\n<|User|>Find state law cases related to land disputes in the past 5 years from 2015 to 2021 in New York.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"lawyer_get_experience\", \"description\": \"Retrieve months of experience of a Lawyer on handling certain type of law cases. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"name\": {\"type\": \"string\", \"description\": \"The full name of the Lawyer.\"}, \"law_type\": {\"type\": \"string\", \"description\": \"The type of law case. eg. Bankruptcy\"}}, \"required\": [\"name\", \"law_type\"]}}}\n```\n<|User|>How many months of experience a Lawyer John Doe has on handling Bankruptcy cases.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"lawsuit_details_find\", \"description\": \"Find details of lawsuits involving a specific company from a given year. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"company_name\": {\"type\": \"string\", \"description\": \"Name of the company.\"}, \"year\": {\"type\": \"integer\", \"description\": \"Year of the lawsuit.\"}, \"case_type\": {\"type\": \"string\", \"description\": \"Type of the lawsuit, e.g., 'IPR', 'Patent', 'Commercial', etc. Default is 'all'.\"}}, \"required\": [\"company_name\", \"year\"]}}}\n```\n<|User|>Find details of patent lawsuits involving the company 'Apple Inc.' from the year 2010.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_lawsuit_details\", \"description\": \"Retrieve the detailed information about a lawsuit based on its case number and the court location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_number\": {\"type\": \"string\", \"description\": \"The case number of the lawsuit.\"}, \"court_location\": {\"type\": \"string\", \"description\": \"The location of the court where the case is filed.\"}, \"additional_details\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"attorneys\", \"plaintiffs\", \"defendants\", \"charges\", \"court_updates\"]}, \"description\": \"Optional. Array containing additional details to be fetched. Default is all.\"}}, \"required\": [\"case_number\", \"court_location\"]}}}\n```\n<|User|>Find details about lawsuit case numbered 'LAX2019080202' in the Los Angeles court.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"find_latest_court_case\", \"description\": \"Find the latest court case between two companies. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"company1\": {\"type\": \"string\", \"description\": \"The name of the first company.\"}, \"company2\": {\"type\": \"string\", \"description\": \"The name of the second company.\"}, \"country\": {\"type\": \"string\", \"description\": \"The country in which the court case is located.\", \"default\": \"USA\"}}, \"required\": [\"company1\", \"company2\"]}}}\n```\n<|User|>Find the latest court case between Apple and Samsung occured in USA.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"lawsuit_info\", \"description\": \"Retrieves details of a lawsuit given a case number Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_number\": {\"type\": \"string\", \"description\": \"The unique identifier of the lawsuit case\"}, \"year\": {\"type\": \"integer\", \"description\": \"The year in which the lawsuit case was initiated. Default is 2023 if not specified.\", \"optional\": true, \"default\": 2023}, \"location\": {\"type\": \"string\", \"description\": \"The location or court jurisdiction where the case was filed. Default is 'all'.\", \"optional\": true}}, \"required\": [\"case_number\"]}}}\n```\n<|User|>Retrieve all the lawsuit details for case number XYZ123.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"lawsuit_search\", \"description\": \"Retrieve all lawsuits involving a particular entity from specified jurisdiction. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"entity\": {\"type\": \"string\", \"description\": \"The entity involved in lawsuits.\"}, \"county\": {\"type\": \"string\", \"description\": \"The jurisdiction for the lawsuit search for example Alameda county.\"}, \"state\": {\"type\": \"string\", \"description\": \"The state for the lawsuit search. Default is California.\"}}, \"required\": [\"entity\", \"county\"]}}}\n```\n<|User|>Search for current lawsuits filed against Apple in Santa Clara County.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"lawsuit_check_case\", \"description\": \"Verify the details of a lawsuit case and check its status using case ID. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"case_id\": {\"type\": \"integer\", \"description\": \"The identification number of the lawsuit case.\"}, \"closed_status\": {\"type\": \"boolean\", \"description\": \"The status of the lawsuit case to be verified.\"}}, \"required\": [\"case_id\", \"closed_status\"]}}}\n```\n<|User|>I need the details of the lawsuit case with case ID of 1234 and verify if it's already closed.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"detailed_weather_forecast\", \"description\": \"Retrieve a detailed weather forecast for a specific location and duration including optional precipitation details. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city name that you want to get the weather for.\"}, \"duration\": {\"type\": \"integer\", \"description\": \"Duration in hours for the detailed forecast.\"}, \"include_precipitation\": {\"type\": \"boolean\", \"description\": \"Whether to include precipitation data in the forecast. Default is false.\"}}, \"required\": [\"location\", \"duration\"]}}}\n```\n<|User|>What will be the weather in New York in the next 72 hours including the precipitation?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"weather_humidity_forecast\", \"description\": \"Retrieve a humidity forecast for a specific location and time frame. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city that you want to get the humidity for.\"}, \"days\": {\"type\": \"integer\", \"description\": \"Number of days for the forecast.\"}, \"min_humidity\": {\"type\": \"integer\", \"description\": \"Minimum level of humidity (in percentage) to filter the result. Default is 0.\"}}, \"required\": [\"location\", \"days\"]}}}\n```\n<|User|>What is the humidity level in Miami, Florida in the upcoming 7 days?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"locate_tallest_mountains\", \"description\": \"Find the tallest mountains within a specified radius of a location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city from which to calculate distance.\"}, \"radius\": {\"type\": \"integer\", \"description\": \"The radius within which to find mountains, measured in kilometers.\"}, \"amount\": {\"type\": \"integer\", \"description\": \"The number of mountains to find, listed from tallest to smallest.\"}}, \"required\": [\"location\", \"radius\", \"amount\"]}}}\n```\n<|User|>Find me the 5 tallest mountains within 50km of Denver, Colorado.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_emissions\", \"description\": \"Calculates the annual carbon dioxide emissions produced by a vehicle based on the distance traveled, the fuel type and the fuel efficiency of the vehicle. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"distance\": {\"type\": \"integer\", \"description\": \"The distance travelled in miles.\"}, \"fuel_type\": {\"type\": \"string\", \"description\": \"Type of fuel used by the vehicle.\"}, \"fuel_efficiency\": {\"type\": \"number\", \"description\": \"The vehicle's fuel efficiency in miles per gallon. This is a float type value.\", \"format\": \"float\"}, \"efficiency_reduction\": {\"type\": \"integer\", \"description\": \"The percentage decrease in fuel efficiency per year (optional). Default is 0\"}}, \"required\": [\"distance\", \"fuel_type\", \"fuel_efficiency\"]}}}\n```\n<|User|>How much CO2 is produced annually by a gas-fueled car that travels 12,000 miles per year, with fuel efficiency of 25 MPG ?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_traffic_info\", \"description\": \"Retrieve current traffic conditions for a specified route. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"start_location\": {\"type\": \"string\", \"description\": \"The starting point of the route.\"}, \"end_location\": {\"type\": \"string\", \"description\": \"The destination of the route.\"}, \"mode\": {\"type\": \"string\", \"enum\": [\"driving\", \"walking\", \"bicycling\", \"transit\"], \"description\": \"Preferred method of transportation, default to 'driving'.\"}}, \"required\": [\"start_location\", \"end_location\"]}}}\n```\n<|User|>Find out the current traffic situation from Boston driving to New York.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"public_library_find_nearby\", \"description\": \"Locate nearby public libraries based on specific criteria like English fiction availability and Wi-Fi. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city and state, e.g. Boston, MA\"}, \"facilities\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"Wi-Fi\", \"Reading Room\", \"Fiction\", \"Children Section\", \"Cafe\"]}, \"description\": \"Facilities and sections in public library.\"}}, \"required\": [\"location\", \"facilities\"]}}}\n```\n<|User|>Locate the nearest public library in Boston, Massachusetts with English fiction section and free Wi-Fi.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"group_dynamics_pattern\", \"description\": \"Examine the social dynamics and interactions within a group based on the personality traits and group size. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"total\": {\"type\": \"integer\", \"description\": \"The total group size.\"}, \"extroverts\": {\"type\": \"integer\", \"description\": \"The number of extroverted members in the group.\"}, \"introverts\": {\"type\": \"integer\", \"description\": \"The number of introverted members in the group.\"}}, \"required\": [\"total\", \"extroverts\", \"introverts\"]}}}\n```\n<|User|>Find social behaviors and patterns in a group size of 50 with extroverted members being 15 and introverted members being 35.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"monarch_getMonarchOfYear\", \"description\": \"Retrieve the monarch of a specific location during a specified year. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The location (e.g., country) whose monarch needs to be found.\"}, \"year\": {\"type\": \"integer\", \"description\": \"The year to search the monarch.\"}, \"fullName\": {\"type\": \"boolean\", \"default\": false, \"description\": \"If true, returns the full name and title of the monarch.\"}}, \"required\": [\"location\", \"year\"]}}}\n```\n<|User|>What was the full name king of England in 1800?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_historical_GDP\", \"description\": \"Retrieve historical GDP data for a specific country and time range. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"country\": {\"type\": \"string\", \"description\": \"The country for which the historical GDP data is required.\"}, \"start_year\": {\"type\": \"integer\", \"description\": \"Starting year of the period for which GDP data is required.\"}, \"end_year\": {\"type\": \"integer\", \"description\": \"Ending year of the period for which GDP data is required.\"}}, \"required\": [\"country\", \"start_year\", \"end_year\"]}}}\n```\n<|User|>Get historical GDP data for United States from 1960 to 2000.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"us_history_get_president\", \"description\": \"Retrieve the U.S. president during a specific event in American history. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"event\": {\"type\": \"string\", \"description\": \"The event in U.S. history.\"}, \"year\": {\"type\": \"integer\", \"description\": \"The specific year of the event.\"}}, \"required\": [\"event\", \"year\"]}}}\n```\n<|User|>Who was the president of the United States during the American Civil War?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"US_president_in_year\", \"description\": \"Retrieve the name of the U.S. president in a given year. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"year\": {\"type\": \"integer\", \"description\": \"The year in question.\"}, \"full_name\": {\"type\": \"boolean\", \"default\": true, \"description\": \"Option to return full name with middle initial, if applicable.\"}}, \"required\": [\"year\"]}}}\n```\n<|User|>Who was the full name of the president of the United States in 1861?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_scientist_for_discovery\", \"description\": \"Retrieve the scientist's name who is credited for a specific scientific discovery or theory. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"discovery\": {\"type\": \"string\", \"description\": \"The scientific discovery or theory.\"}}, \"required\": [\"discovery\"]}}}\n```\n<|User|>Who is the scientist that first proposed the theory of evolution?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_discoverer\", \"description\": \"Get the person or team who made a particular scientific discovery Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"discovery\": {\"type\": \"string\", \"description\": \"The discovery for which the discoverer's information is needed.\"}, \"detail\": {\"type\": \"boolean\", \"description\": \"Optional flag to get additional details about the discoverer, such as birth date and nationality. Defaults to false.\"}}, \"required\": [\"discovery\", \"detail\"]}}}\n```\n<|User|>Who discovered the neutron? Give me detail information.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"discoverer_get\", \"description\": \"Retrieve the name of the discoverer of an element based on its name. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"element_name\": {\"type\": \"string\", \"description\": \"The name of the element.\"}, \"year\": {\"type\": \"integer\", \"description\": \"Optional parameter that refers to the year of discovery. It could be helpful in case an element was discovered more than once. Default to 0, which means not use it.\"}, \"first\": {\"type\": \"boolean\", \"default\": true, \"description\": \"Optional parameter indicating if the first discoverer's name should be retrieved.\"}}, \"required\": [\"element_name\"]}}}\n```\n<|User|>Who discovered radium?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"historical_contrib_get_contrib\", \"description\": \"Retrieve historical contribution made by a scientist on a specific date. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"scientist\": {\"type\": \"string\", \"description\": \"The scientist whose contributions need to be searched.\"}, \"date\": {\"type\": \"string\", \"description\": \"The date when the contribution was made in yyyy-mm-dd format.\"}, \"category\": {\"type\": \"string\", \"description\": \"The field of the contribution, such as 'Physics' or 'Chemistry'. Default is 'all'.\"}}, \"required\": [\"scientist\", \"date\"]}}}\n```\n<|User|>What was Albert Einstein's contribution to science on March 17, 1915?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"religion_history_info\", \"description\": \"Provides comprehensive historical details about a specified religion till a specified century. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"religion\": {\"type\": \"string\", \"description\": \"The name of the religion for which historical details are needed.\"}, \"till_century\": {\"type\": \"integer\", \"description\": \"The century till which historical details are needed.\"}, \"include_people\": {\"type\": \"boolean\", \"description\": \"To include influential people related to the religion during that time period, default is False\"}}, \"required\": [\"religion\", \"till_century\"]}}}\n```\n<|User|>Tell me more about Christianity and its history till the 14th century<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"sculpture_search\", \"description\": \"Find sculptures based on location and a specific time frame. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city where the sculptures are located.\"}, \"time_frame\": {\"type\": \"string\", \"description\": \"The time frame during which the sculptures were made.\"}, \"material\": {\"type\": \"string\", \"description\": \"Optional material of the sculptures. Default is 'all'\"}}, \"required\": [\"location\", \"time_frame\"]}}}\n```\n<|User|>Find me sculptures near Chicago that were made in the 19th century.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"find_exhibition\", \"description\": \"Locate the most popular exhibitions based on criteria like location, time, art form, and user ratings. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city and state where the exhibition is held, e.g., New York City, NY.\"}, \"art_form\": {\"type\": \"string\", \"description\": \"The form of art the exhibition is displaying e.g., sculpture.\"}, \"month\": {\"type\": \"string\", \"description\": \"The month of exhibition. Default value will return upcoming events if not specified.\"}, \"user_ratings\": {\"type\": \"string\", \"enum\": [\"low\", \"average\", \"high\"], \"description\": \"Select exhibitions with user rating threshold. Default is 'low'\"}}, \"required\": [\"location\", \"art_form\"]}}}\n```\n<|User|>Find the top rated modern sculpture exhibition happening in New York in the upcoming month.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"sculpture_locator_find_by_artist\", \"description\": \"Locate the sculptures of specific artist by material and location Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"artist\": {\"type\": \"string\", \"description\": \"Name of the Artist of the sculpture\"}, \"material\": {\"type\": \"string\", \"description\": \"Material of the sculpture.\"}, \"location\": {\"type\": \"string\", \"description\": \"The location where you want to find the sculpture. Default is 'all' if not specified.\"}}, \"required\": [\"artist\", \"material\"]}}}\n```\n<|User|>Find me the sculptures of Michelangelo with material Marble in Rome, Italy.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"calculate_compound_interest\", \"description\": \"Calculates the compound interest of an investment over a given time period. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"principle\": {\"type\": \"integer\", \"description\": \"The initial amount of the investment.\"}, \"interest_rate\": {\"type\": \"number\", \"description\": \"The yearly interest rate of the investment. This is a float type value.\", \"format\": \"float\"}, \"time\": {\"type\": \"integer\", \"description\": \"The time, in years, the money is invested or borrowed for.\"}, \"compounds_per_year\": {\"type\": \"integer\", \"description\": \"The number of times the interest is compounded per year. Default is 1 (interest is compounded yearly).\"}}, \"required\": [\"principle\", \"interest_rate\", \"time\"]}}}\n```\n<|User|>Calculate the compound interest of an investment of $10,000 at an interest rate of 5% compounded yearly for 10 years.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"building_get_dimensions\", \"description\": \"Retrieve the dimensions of a specific building based on its name. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"building_name\": {\"type\": \"string\", \"description\": \"The name of the building.\"}, \"unit\": {\"type\": \"string\", \"description\": \"The unit in which you want the dimensions. Default is meter.\", \"enum\": [\"meter\", \"feet\"]}}, \"required\": [\"building_name\", \"unit\"]}}}\n```\n<|User|>Can you give me the height and width of Empire State building in feet?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"metropolitan_museum_get_top_artworks\", \"description\": \"Fetches the list of popular artworks at the Metropolitan Museum of Art. Results can be sorted based on popularity. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"number\": {\"type\": \"integer\", \"description\": \"The number of artworks to fetch\"}, \"sort_by\": {\"type\": \"string\", \"description\": \"The criteria to sort the results on. Default is 'popularity'.\", \"enum\": [\"popularity\", \"chronological\", \"alphabetical\"]}}, \"required\": [\"number\"]}}}\n```\n<|User|>Get the list of top 5 popular artworks at the Metropolitan Museum of Art. Please sort by popularity.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"concert_find_nearby\", \"description\": \"Locate nearby concerts based on specific criteria like genre. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city and state, e.g. Seattle, WA\"}, \"genre\": {\"type\": \"string\", \"description\": \"Genre of music to be played at the concert.\"}}, \"required\": [\"location\", \"genre\"]}}}\n```\n<|User|>Find concerts near me in Seattle that plays jazz music.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"music_composer_create_mix\", \"description\": \"Create a mix of a song based on a particular music scale and duration Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"scale\": {\"type\": \"string\", \"description\": \"The musical scale to be used. E.g: C Major, A Minor, etc.\"}, \"note_duration\": {\"type\": \"string\", \"description\": \"Duration of each note. Options: 'whole', 'half', 'quarter', 'eighth', 'sixteenth'.\", \"enum\": [\"whole\", \"half\", \"quarter\", \"eighth\", \"sixteenth\"]}, \"track_length\": {\"type\": \"integer\", \"description\": \"Length of the mix track in seconds.\"}}, \"required\": [\"scale\", \"note_duration\", \"track_length\"]}}}\n```\n<|User|>Create a mix track using notes of C major scale and duration of each note being quarter of a second with a duration of 3 minutes.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"music_generation_create_chord_progression\", \"description\": \"Create a chord progression in a specific key and number of chords. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"key\": {\"type\": \"string\", \"description\": \"The key for the chord progression.\"}, \"chords\": {\"type\": \"integer\", \"description\": \"Number of chords in the progression.\"}, \"progression_type\": {\"type\": \"string\", \"description\": \"The type of the chord progression. Optional parameter. Default is 'major'.\"}}, \"required\": [\"key\", \"chords\"]}}}\n```\n<|User|>Generate a major chord progression in C key with four chords.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"music_theory_chordProgression\", \"description\": \"Identifies a potential key signature for the given chord progression. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"progression\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"The chord progression in Roman numerals. Eg: ['I', 'V', 'vi', 'IV'].\"}, \"returnAllPossibleKeys\": {\"type\": \"boolean\", \"description\": \"Flag indicating if the function should return all possible key signatures that fit the chord progression. If false, the function will return the first valid key it finds. Default is false.\"}, \"assumeMajor\": {\"type\": \"boolean\", \"description\": \"Assumption if the key signature is Major. If true, the function will assume the key signature to be major and otherwise minor. Default is true.\"}}, \"required\": [\"progression\"]}}}\n```\n<|User|>music.theory.chordProgression(progression=['I', 'V', 'vi', 'IV'])<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"musical_scale\", \"description\": \"Get the musical scale of a specific key in music theory. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"key\": {\"type\": \"string\", \"description\": \"The musical key for which the scale will be found.\"}, \"scale_type\": {\"type\": \"string\", \"default\": \"major\", \"description\": \"The type of musical scale.\"}}, \"required\": [\"key\"]}}}\n```\n<|User|>What is the musical scale associated with C sharp major?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"music_calculate_note_duration\", \"description\": \"Calculate the duration between two notes based on their frequencies and harmonic rhythm. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"first_note_frequency\": {\"type\": \"integer\", \"description\": \"The frequency of the first note in Hz.\"}, \"second_note_frequency\": {\"type\": \"integer\", \"description\": \"The frequency of the second note in Hz.\"}, \"tempo\": {\"type\": \"integer\", \"description\": \"The tempo of the music in beats per minute. Defaults to 120 beats per minute.\"}}, \"required\": [\"first_note_frequency\", \"second_note_frequency\"]}}}\n```\n<|User|>Calculate the duration between two notes of 440Hz and 880Hz frequency based on harmonic rhythm.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"game_result_get_winner\", \"description\": \"Get the winner of a specific basketball game. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"teams\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"List of two teams who played the game.\"}, \"date\": {\"type\": \"string\", \"description\": \"The date of the game, formatted as YYYY-MM-DD.\"}, \"venue\": {\"type\": \"string\", \"optional\": true, \"description\": \"Optional: The venue of the game. Default is 'home'.\"}}, \"required\": [\"teams\", \"date\"]}}}\n```\n<|User|>Who won the basketball game between Lakers and Clippers on Jan 28, 2021?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_sport_ranking\", \"description\": \"Retrieve the current world ranking of a sportsperson based on the sport and player's name. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"sport\": {\"type\": \"string\", \"description\": \"Name of the sport.\"}, \"player_name\": {\"type\": \"string\", \"description\": \"Name of the player.\"}, \"gender\": {\"type\": \"string\", \"description\": \"Gender of the player. This is optional. The possible values are male or female.\", \"default\": \"all\"}}, \"required\": [\"sport\", \"player_name\"]}}}\n```\n<|User|>Find the current world rank of a Tennis player, Serena Williams.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_team_rank\", \"description\": \"Get the team ranking in a sports league based on season and type. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"team_name\": {\"type\": \"string\", \"description\": \"The name of the sports team.\"}, \"league\": {\"type\": \"string\", \"description\": \"The name of the league in which the team competes.\"}, \"season\": {\"type\": \"string\", \"description\": \"The season for which the team's ranking is sought.\"}, \"type\": {\"type\": \"string\", \"description\": \"Type of the season: regular or playoff.\", \"enum\": [\"regular\", \"playoff\"]}}, \"required\": [\"team_name\", \"league\", \"season\", \"type\"]}}}\n```\n<|User|>Find the ranking of LA Lakers in the NBA 2021 regular season.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"sports_ranking_get_team_position\", \"description\": \"Retrieve a team's position and stats in the basketball league for a given season. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"team\": {\"type\": \"string\", \"description\": \"The name of the team.\"}, \"season\": {\"type\": \"string\", \"description\": \"The season for which data should be fetched.\"}, \"detailed\": {\"type\": \"boolean\", \"description\": \"Flag to retrieve detailed stats or just the position.\", \"default\": false}}, \"required\": [\"team\", \"season\"]}}}\n```\n<|User|>Fetch the basketball league standings, where Golden State Warriors stand in current 2022-2023 season with details<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"sports_team_get_schedule\", \"description\": \"Fetches the schedule of the specified sports team for the specified number of games in the given league. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"team_name\": {\"type\": \"string\", \"description\": \"The name of the sports team.\"}, \"num_of_games\": {\"type\": \"integer\", \"description\": \"Number of games for which to fetch the schedule.\"}, \"league\": {\"type\": \"string\", \"description\": \"The name of the sports league. If not provided, the function will fetch the schedule for all games, regardless of the league.\"}, \"location\": {\"type\": \"string\", \"description\": \"Optional. The city or venue where games are to be held. If not provided, default that all venues will be considered.\"}}, \"required\": [\"team_name\", \"num_of_games\", \"league\"]}}}\n```\n<|User|>Give me the schedule of Manchester United for the next 6 games in Premier League.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"boardgame_get_info\", \"description\": \"Retrieve detailed information of a board game. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"name\": {\"type\": \"string\", \"description\": \"Name of the board game.\"}, \"parameters\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"player count\", \"playing time\", \"age\", \"mechanics\", \"rating\"]}, \"description\": \"Game characteristics interested.\"}, \"language\": {\"type\": \"string\", \"description\": \"The preferred language for the game information, default is English\"}}, \"required\": [\"name\", \"parameters\"]}}}\n```\n<|User|>Find the rating and player count of the board game 'Ticket to Ride'.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"board_game_info\", \"description\": \"Get the information about a board game from a database.  Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"game_name\": {\"type\": \"string\", \"description\": \"Name of the board game.\"}, \"info_required\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"average_review_rating\", \"age_range\", \"number_of_players\", \"playing_time\", \"genre\"]}, \"description\": \"Array of information requested for the game.\"}}, \"required\": [\"game_name\", \"info_required\"]}}}\n```\n<|User|>What's the average review rating and the age range for the board game 'Catan'?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"board_game_chess_get_top_players\", \"description\": \"Find top chess players in a location based on rating. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city you want to find the players from.\"}, \"minimum_rating\": {\"type\": \"integer\", \"description\": \"Minimum rating to filter the players.\"}, \"number_of_players\": {\"type\": \"integer\", \"default\": 10, \"description\": \"Number of players you want to retrieve, default value is 10\"}}, \"required\": [\"location\", \"minimum_rating\"]}}}\n```\n<|User|>Find the top chess players in New York with a rating above 2300.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"blackjack_check_winner\", \"description\": \"Checks and determines the winner in a game of blackjack. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"player_cards\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"Cards held by the player.\"}, \"dealer_cards\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"Cards held by the dealer.\"}, \"ace_value\": {\"type\": \"integer\", \"description\": \"The value considered for the ace card, can be either 1 or 11.\", \"default\": 11}}, \"required\": [\"player_cards\", \"dealer_cards\"]}}}\n```\n<|User|>Check who is the winner in a game of blackjack given player having A and 10, dealer having 10 and 9. The Ace is considered 1.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"card_game_probability_calculate\", \"description\": \"Calculate the probability of drawing a certain card or suit from a deck of cards. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"total_cards\": {\"type\": \"integer\", \"description\": \"Total number of cards in the deck.\"}, \"desired_cards\": {\"type\": \"integer\", \"description\": \"Number of cards in the deck that satisfy the conditions.\"}, \"cards_drawn\": {\"type\": \"integer\", \"default\": 1, \"description\": \"Number of cards drawn from the deck.\"}}, \"required\": [\"total_cards\", \"desired_cards\"]}}}\n```\n<|User|>What is the probability of drawing a heart card from a deck of 52 cards?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"card_games_poker_determine_winner\", \"description\": \"Determines the winner in a game of Poker based on the cards in each players' hands. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"player1\": {\"type\": \"string\", \"description\": \"The first player's name.\"}, \"hand1\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"The list of cards (as strings) in first player's hand. E.g ['10♠', 'J♠']\"}, \"player2\": {\"type\": \"string\", \"description\": \"The second player's name.\"}, \"hand2\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"The list of cards (as strings) in second player's hand. E.g ['9♥', '10♥']\"}}, \"required\": [\"player1\", \"hand1\", \"player2\", \"hand2\"]}}}\n```\n<|User|>Determine the winner in a Poker game with John having a Hand of 8♥, 10♥, J♥, Q♥, K♥ and Mike having 9♠, J♠, 10♠, Q♠, K♠.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"game_list_get_games\", \"description\": \"Get a list of video games based on release year, multiplayer functionality and ESRB rating Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"release_year\": {\"type\": \"integer\", \"description\": \"The year the game was released.\"}, \"multiplayer\": {\"type\": \"boolean\", \"description\": \"Whether the game has multiplayer functionality.\"}, \"ESRB_rating\": {\"type\": \"string\", \"description\": \"The ESRB rating of the game.\"}}, \"required\": [\"release_year\", \"multiplayer\", \"ESRB_rating\"]}}}\n```\n<|User|>Find all multi-player games released in 2019 with an ESRB rating of 'Everyone'<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"game_stats_fetch_player_statistics\", \"description\": \"Fetch player statistics for a specific video game for a given user. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"game\": {\"type\": \"string\", \"description\": \"The name of the video game.\"}, \"username\": {\"type\": \"string\", \"description\": \"The username of the player.\"}, \"platform\": {\"type\": \"string\", \"description\": \"The platform user is playing on.\", \"default\": \"PC\"}}, \"required\": [\"game\", \"username\"]}}}\n```\n<|User|>Fetch player statistics of 'Zelda' on Switch for user 'Sam'.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"game_valuation\", \"description\": \"Get the current market value of a vintage video game. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"game_name\": {\"type\": \"string\", \"description\": \"The name of the game.\"}, \"release_year\": {\"type\": \"integer\", \"description\": \"The year the game was released.\"}, \"condition\": {\"type\": \"string\", \"enum\": [\"New\", \"Like New\", \"Used\", \"Fair\", \"Poor\"], \"description\": \"The condition of the game. Default is 'Used'.\"}}, \"required\": [\"game_name\", \"release_year\"]}}}\n```\n<|User|>Find the value of a vintage Super Mario Bros. game from 1985 like new.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_collectables_in_season\", \"description\": \"Retrieve a list of collectable items in a specific game during a specified season. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"game_name\": {\"type\": \"string\", \"description\": \"Name of the game.\"}, \"season\": {\"type\": \"string\", \"description\": \"The season for which to retrieve the collectable items.\"}, \"item_type\": {\"type\": \"string\", \"description\": \"The type of item to search for. Default is 'all'. Possible values: 'all', 'bug', 'fish', 'sea creatures', etc.\"}}, \"required\": [\"game_name\", \"season\"]}}}\n```\n<|User|>Get all collectable items from the game 'Animal Crossing: New Horizons' during the Spring season.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"create_player_profile\", \"description\": \"Create a new player profile with character name, class and starting level. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"player_name\": {\"type\": \"string\", \"description\": \"The desired name of the player.\"}, \"_class\": {\"type\": \"string\", \"description\": \"The character class for the player\"}, \"starting_level\": {\"type\": \"integer\", \"description\": \"The starting level for the player\", \"default\": 1}}, \"required\": [\"player_name\", \"_class\"]}}}\n```\n<|User|>Create a new player profile for the game with name 'StarPlayer' and character class 'Mage', set the starting level to 5.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"game_score_highest\", \"description\": \"Retrieve the highest score achieved by any player in a specific game. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"game\": {\"type\": \"string\", \"description\": \"The name of the online game.\"}, \"platform\": {\"type\": \"string\", \"description\": \"The platform where the game is played, e.g. PC, Xbox, Playstation\"}, \"region\": {\"type\": \"string\", \"description\": \"The geographic region of the player. Defaults to 'Global'\"}}, \"required\": [\"game\", \"platform\"]}}}\n```\n<|User|>Find the highest score achieved by any player in the online game 'Overwatch' on PC globally.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"multiplayer_game_finder\", \"description\": \"Locate multiplayer games that match specific criteria such as rating, platform compatibility, genre, etc. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"platform\": {\"type\": \"string\", \"description\": \"The platform you want the game to be compatible with, e.g. Windows 10, PS5.\"}, \"rating\": {\"type\": \"number\", \"description\": \"Desired minimum game rating on a 5.0 scale. This is a float type value.\", \"format\": \"float\"}, \"genre\": {\"type\": \"string\", \"description\": \"Desired game genre, e.g. Action, Adventure, Racing. Default is 'Action'.\", \"enum\": [\"Action\", \"Adventure\", \"Racing\", \"Strategy\", \"Simulation\"]}}, \"required\": [\"platform\", \"rating\"]}}}\n```\n<|User|>Find me a multiplayer game with rating above 4.5 and compatible with Windows 10.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"recipe_search\", \"description\": \"Search for a recipe given dietary restriction, ingredients, and number of servings. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"dietary_restriction\": {\"type\": \"string\", \"description\": \"The dietary restriction, e.g., 'Vegetarian'.\"}, \"ingredients\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"The list of ingredients.\"}, \"servings\": {\"type\": \"integer\", \"description\": \"The number of servings the recipe should make\"}}, \"required\": [\"dietary_restriction\", \"ingredients\", \"servings\"]}}}\n```\n<|User|>Give me a recipe for a vegetarian pasta with cheese for 2 servings.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"cooking_conversion_convert\", \"description\": \"Convert cooking measurements from one unit to another. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"quantity\": {\"type\": \"integer\", \"description\": \"The quantity to be converted.\"}, \"from_unit\": {\"type\": \"string\", \"description\": \"The unit to convert from.\"}, \"to_unit\": {\"type\": \"string\", \"description\": \"The unit to convert to.\"}, \"item\": {\"type\": \"string\", \"description\": \"The item to be converted.\"}}, \"required\": [\"quantity\", \"from_unit\", \"to_unit\", \"item\"]}}}\n```\n<|User|>How many ounces in 2 pounds of butter?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"recipe_unit_conversion\", \"description\": \"Convert a value from one kitchen unit to another for cooking purposes. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"value\": {\"type\": \"integer\", \"description\": \"The value to be converted.\"}, \"from_unit\": {\"type\": \"string\", \"description\": \"The unit to convert from. Supports 'teaspoon', 'tablespoon', 'cup', etc.\"}, \"to_unit\": {\"type\": \"string\", \"description\": \"The unit to convert to. Supports 'teaspoon', 'tablespoon', 'cup', etc.\"}, \"precision\": {\"type\": \"integer\", \"description\": \"The precision to round the output to, in case of a non-integer result. Optional, default is 1.\"}}, \"required\": [\"value\", \"from_unit\", \"to_unit\"]}}}\n```\n<|User|>How many teaspoons are in 2 tablespoons for measurement in my recipe?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"whole_foods_check_price\", \"description\": \"Check the price of items at a specific Whole Foods location. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"Location of the Whole Foods store.\"}, \"items\": {\"type\": \"array\", \"items\": {\"type\": \"string\"}, \"description\": \"List of items for which the price needs to be checked.\"}}, \"required\": [\"location\", \"items\"]}}}\n```\n<|User|>Check the price of tomatoes and lettuce at the Whole Foods in Los Angeles.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"whole_foods_find_top_brands\", \"description\": \"Get top brands based on a specific product from Whole Foods Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"product\": {\"type\": \"string\", \"description\": \"The product for which the top brands should be fetched.\"}, \"number\": {\"type\": \"integer\", \"description\": \"Number of top brands to be fetched. Default is 5\"}, \"organic\": {\"type\": \"boolean\", \"description\": \"If the product should be organic. Default is false\"}}, \"required\": [\"product\"]}}}\n```\n<|User|>Find the top five organic bananas brands on the basis of rating from Whole Foods store.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"grocery_info_nutritional_info\", \"description\": \"Retrieve nutritional information for a given food item from a particular store Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"store\": {\"type\": \"string\", \"description\": \"The store where the item is available\"}, \"food\": {\"type\": \"string\", \"description\": \"Food item for which information is needed.\"}, \"information\": {\"type\": \"array\", \"items\": {\"type\": \"string\", \"enum\": [\"Protein\", \"Calories\", \"Carbohydrates\", \"Fat\", \"Fiber\"]}, \"description\": \"Nutritional details required.\"}}, \"required\": [\"store\", \"food\", \"information\"]}}}\n```\n<|User|>Check the amount of protein, calories and carbs in an avocado from Walmart.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"time_zone_converter\", \"description\": \"Retrieve the current time of a specific city. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"city\": {\"type\": \"string\", \"description\": \"The city you want to know the current time for.\"}, \"country\": {\"type\": \"string\", \"description\": \"The country where the city is located.\"}, \"display_format\": {\"type\": \"string\", \"description\": \"The time display format: '12h' or '24h'. Default is '24h'.\"}}, \"required\": [\"city\", \"country\"]}}}\n```\n<|User|>What time is it currently in London, UK in 24 hour format?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_current_time\", \"description\": \"Retrieve the current time for a specified city and country. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"city\": {\"type\": \"string\", \"description\": \"The city for which the current time is to be retrieved.\"}, \"country\": {\"type\": \"string\", \"description\": \"The country where the city is located.\"}, \"format\": {\"type\": \"string\", \"description\": \"The format in which the time is to be displayed, optional (defaults to 'HH:MM:SS').\"}}, \"required\": [\"city\", \"country\"]}}}\n```\n<|User|>What is the current time in Sydney, Australia?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_current_time\", \"description\": \"Retrieve the current time in a specific time zone. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The name of the city.\"}, \"country\": {\"type\": \"string\", \"description\": \"The name of the country.\"}, \"timezone\": {\"type\": \"string\", \"description\": \"The optional timezone to get current time. Default \"}}, \"required\": [\"location\", \"country\"]}}}\n```\n<|User|>What's the current time in Sydney, Australia?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"book_hotel\", \"description\": \"Book a room of specified type for a particular number of nights at a specific hotel, starting from a specified date. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"hotel_name\": {\"type\": \"string\", \"description\": \"The name of the hotel.\"}, \"location\": {\"type\": \"string\", \"description\": \"The city in which the hotel is located.\"}, \"room_type\": {\"type\": \"string\", \"description\": \"The type of room to be booked.\"}, \"start_date\": {\"type\": \"string\", \"description\": \"The start date for the booking.\"}, \"nights\": {\"type\": \"integer\", \"description\": \"The number of nights for which the booking is to be made.\"}}, \"required\": [\"hotel_name\", \"location\", \"room_type\", \"start_date\", \"nights\"]}}}\n```\n<|User|>Book a single room for two nights at the Hilton Hotel in Chicago, starting from 10th December 2022.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"book_room\", \"description\": \"Book a room in a specified hotel. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"hotel_name\": {\"type\": \"string\", \"description\": \"The name of the hotel.\"}, \"room_type\": {\"type\": \"string\", \"description\": \"The type of room to be booked.\"}, \"num_nights\": {\"type\": \"integer\", \"description\": \"The number of nights to book the room for.\"}}, \"required\": [\"hotel_name\", \"room_type\", \"num_nights\"]}}}\n```\n<|User|>I would like to book a single room for two nights at The Plaza hotel.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"currency_converter\", \"description\": \"Calculates the current cost in target currency given the amount in base currency and exchange rate Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"base_currency\": {\"type\": \"string\", \"description\": \"The currency to convert from.\"}, \"target_currency\": {\"type\": \"string\", \"description\": \"The currency to convert to.\"}, \"amount\": {\"type\": \"number\", \"description\": \"The amount in base currency This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"base_currency\", \"target_currency\", \"amount\"]}}}\n```\n<|User|>Calculate the current cost in British Pounds if I need to convert 200 US dollars.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"get_exchange_rate_with_fee\", \"description\": \"Retrieve the exchange rate between two currencies including transaction fee. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"base_currency\": {\"type\": \"string\", \"description\": \"The base currency.\"}, \"target_currency\": {\"type\": \"string\", \"description\": \"The target currency.\"}, \"fee\": {\"type\": \"number\", \"description\": \"The transaction fee in percentage. Default is 0%. This is a float type value.\", \"format\": \"float\"}}, \"required\": [\"base_currency\", \"target_currency\", \"fee\"]}}}\n```\n<|User|>Get the exchange rate from British pounds to Japanese yen with the fee 0.02 included.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"convert_currency\", \"description\": \"Converts an amount from a particular currency to another currency. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"base_currency\": {\"type\": \"string\", \"description\": \"The base currency in which the original amount is present.\"}, \"target_currency\": {\"type\": \"string\", \"description\": \"The currency to which you want to convert.\"}, \"amount\": {\"type\": \"integer\", \"description\": \"The amount you want to convert.\"}}, \"required\": [\"base_currency\", \"target_currency\", \"amount\"]}}}\n```\n<|User|>How much will 20000 Japanese Yen be in United States Dollar?<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"maps_get_distance_duration\", \"description\": \"Retrieve the travel distance and estimated travel time from one location to another via car Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"start_location\": {\"type\": \"string\", \"description\": \"Starting point of the journey\"}, \"end_location\": {\"type\": \"string\", \"description\": \"Ending point of the journey\"}, \"traffic\": {\"type\": \"boolean\", \"description\": \"If true, considers current traffic. Default is false.\"}}, \"required\": [\"start_location\", \"end_location\"]}}}\n```\n<|User|>Get me the travel distance and duration from the Eiffel Tower to the Louvre Museum<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"parking_lot_find_nearest\", \"description\": \"Locate the nearest parking lot based on a specific location and radius. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The reference location e.g. Central Park, NY\"}, \"radius\": {\"type\": \"integer\", \"description\": \"The maximum distance from the location in miles. Default is 5 miles\"}, \"type\": {\"type\": \"string\", \"description\": \"The type of parking lot. Default is 'public'.\"}}, \"required\": [\"location\", \"radius\"]}}}\n```\n<|User|>Find the nearest parking lot within 2 miles of Central Park in New York.<|Assistant|>",
  "\n<|begin▁of▁sentence|>\n\n\nYou are a helpful assistant with tool calling capabilities. When a tool call is needed, you MUST use the following format to issue the call:\n<|tool▁calls▁begin|><|tool▁call▁begin|>function<|tool▁sep|>FUNCTION_NAME\n```json\n{\"param1\": \"value1\", \"param2\": \"value2\"}\n```<|tool▁call▁end|><|tool▁calls▁end|>\n\nMake sure the JSON is valid.## Tools\n\n### Function\n\nYou have the following functions available:\n\n\n```json\n{\"type\": \"function\", \"function\": {\"name\": \"restaurant_search\", \"description\": \"Locates top rated restaurants based on specific criteria such as type of cuisine, ratings, and facilities. Note that the provided function is in Python 3 syntax.\", \"parameters\": {\"type\": \"object\", \"properties\": {\"location\": {\"type\": \"string\", \"description\": \"The city and state, e.g. New York City, NY\"}, \"cuisine\": {\"type\": \"string\", \"description\": \"Preferred type of cuisine e.g., Italian, Indian, American, etc.\"}, \"rating\": {\"type\": \"integer\", \"description\": \"Minimum average customer rating out of 5\"}, \"accepts_credit_cards\": {\"type\": \"boolean\", \"description\": \"If the restaurant should accept credit cards.\"}}, \"required\": [\"location\", \"cuisine\", \"rating\", \"accepts_credit_cards\"]}}}\n```\n<|User|>Find me the best Italian restaurants in New York City with average customer ratings of more than 4 and accepts credit cards.<|Assistant|>"
]