# This is a 13 line python function to calculate the sgRNA on-target efficacy score from the article
# "Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene inactivation"
# by J Doench et al. 2014
# The authors' web tool is available at http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design
# Thanks to Cameron Mac Pherson at Pasteur Paris for fixing my original version. Maximilian Haeussler 2014
 
import math
 
params = [
# pasted/typed table from PDF and converted to zero-based positions
(1,'G',-0.2753771),(2,'A',-0.3238875),(2,'C',0.17212887),(3,'C',-0.1006662),
(4,'C',-0.2018029),(4,'G',0.24595663),(5,'A',0.03644004),(5,'C',0.09837684),
(6,'C',-0.7411813),(6,'G',-0.3932644),(11,'A',-0.466099),(14,'A',0.08537695),
(14,'C',-0.013814),(15,'A',0.27262051),(15,'C',-0.1190226),(15,'T',-0.2859442),
(16,'A',0.09745459),(16,'G',-0.1755462),(17,'C',-0.3457955),(17,'G',-0.6780964),
(18,'A',0.22508903),(18,'C',-0.5077941),(19,'G',-0.4173736),(19,'T',-0.054307),
(20,'G',0.37989937),(20,'T',-0.0907126),(21,'C',0.05782332),(21,'T',-0.5305673),
(22,'T',-0.8770074),(23,'C',-0.8762358),(23,'G',0.27891626),(23,'T',-0.4031022),
(24,'A',-0.0773007),(24,'C',0.28793562),(24,'T',-0.2216372),(27,'G',-0.6890167),
(27,'T',0.11787758),(28,'C',-0.1604453),(29,'G',0.38634258),(1,'GT',-0.6257787),
(4,'GC',0.30004332),(5,'AA',-0.8348362),(5,'TA',0.76062777),(6,'GG',-0.4908167),
(11,'GG',-1.5169074),(11,'TA',0.7092612),(11,'TC',0.49629861),(11,'TT',-0.5868739),
(12,'GG',-0.3345637),(13,'GA',0.76384993),(13,'GC',-0.5370252),(16,'TG',-0.7981461),
(18,'GG',-0.6668087),(18,'TC',0.35318325),(19,'CC',0.74807209),(19,'TG',-0.3672668),
(20,'AC',0.56820913),(20,'CG',0.32907207),(20,'GA',-0.8364568),(20,'GG',-0.7822076),
(21,'TC',-1.029693),(22,'CG',0.85619782),(22,'CT',-0.4632077),(23,'AA',-0.5794924),
(23,'AG',0.64907554),(24,'AG',-0.0773007),(24,'CG',0.28793562),(24,'TG',-0.2216372),
(26,'GT',0.11787758),(28,'GG',-0.69774)]
 
intercept =  0.59763615
gcHigh    = -0.1665878
gcLow     = -0.2026259
 
def calcDoenchScore(seq):
    score = intercept
 
    guideSeq = seq[4:24]
    gcCount = guideSeq.count("G") + guideSeq.count("C")
    if gcCount <= 10:
        gcWeight = gcLow
    if gcCount > 10:
        gcWeight = gcHigh
    score += abs(10-gcCount)*gcWeight
 
    for pos, modelSeq, weight in params:
        subSeq = seq[pos:pos+len(modelSeq)]
        if subSeq==modelSeq:
            score += weight
    return 1.0/(1.0+math.exp(-score))
 
print "expected result:", 0.713089368437
print calcDoenchScore("TATAGCTGCGATCTGAGGTAGGGAGGGACC")
print "expected result:", 0.0189838463593
print calcDoenchScore("TCCGCACCTGTCACGGTCGGGGCTTGGCGC")